Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 3

Pacjenci z leczonymi przerzutami do mózgu mogli się zapisać, jeśli guzy były stabilne radiologicznie przez co najmniej 8 tygodni. Główne kryteria wykluczenia obejmowały historię choroby autoimmunologicznej lub inne choroby wymagające ogólnoustrojowego leczenia glikokortykoidami lub immunosupresyjne, poprzednia terapia przeciwciałami modulującymi komórki T (w tym anty-PD-1, anty-PD-L1 i anty-CTLA-4), historię zakażenia ludzkim wirusem upośledzenia odporności lub aktywne zakażenie wirusem zapalenia wątroby typu B lub C.
Badanie Leczenie i ocena bezpieczeństwa
Pacjenci byli leczeni w 6-tygodniowych cyklach. Przeciwciało anty-PD-L1 podawano jako 60-minutowy wlew dożylny w dniach 1, 15 i 29 każdego cyklu. Continue reading „Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 3”

Leczeniem odkazajacym narzad oddechowy jest

Leczeniem odkażającym narząd oddechowy jest również leczenie nowarsenobenzolem TYTUL Leczeniem odkażającym narząd oddechowy jest również leczenie nowarsenobenzolem lub neosalutanem w postaci dożylnego wstrzykiwania. Leki te działają skutecznie zwłaszcza w tych przypadkach, w których czynnikiem chorobotwórczym są krętki. Wstrzykuje się nowarsenobenzol, lub neosalutan w dawkach wzrastających raz w tygodniu, zaczynając od 0,15 i dochodząc do 0,3. W razie niemożności z jakiejkolwiek przyczyny zastosowania dożylnego można uciec się do wprowadzenia arsenobenzolu w czopkach Corbierea (po czopku zawierającym 0,1 leku co dzień okresami po 12 dni z 10-dniowymi przerwami po każdym okresie) albo też zastąpić leczenie salwarsanowe leczeniem acetylarsenem. Lek ten wstrzykuje się domięśniowo lub podskórnie co 3 dni okresami po 16 wstrzykiwań z przerwą co najmniej miesięczną po ukończonym okresie. Continue reading „Leczeniem odkazajacym narzad oddechowy jest”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

Śmiertelność i choroby sercowo-naczyniowe w cukrzycy typu 1 i 2 ad 6

W grupie pacjentów z cukrzycą typu 2 zaobserwowano 18% większe zmniejszenie częstości hospitalizacji z powodu niewydolności serca (współczynnik ryzyka, 1,18, 95% CI, 1,12 do 1,23, P <0,001) (ryc. S1 i S2 oraz tabele S8 i S9 w Dodatku Uzupełniającym). Dyskusja
Nasza analiza szwedzkich danych z całego kraju z lat 1998-2014 wykazała wyraźne zmniejszenie śmiertelności oraz częstości występowania powikłań sercowo-naczyniowych u osób dorosłych z cukrzycą typu lub cukrzycą typu 2. Zmniejszenie częstości zgonów nie różniło się istotnie pomiędzy pacjentami z cukrzycą typu a grupą kontrolną, podczas gdy pacjenci z cukrzycą typu 2 mieli mniejszy odsetek śmiertelnych wypadków niż osoby kontrolne. Tempo niepowodzeń nie było jednak większe u pacjentów z cukrzycą niż w odpowiedniej grupie kontrolnej. Continue reading „Śmiertelność i choroby sercowo-naczyniowe w cukrzycy typu 1 i 2 ad 6”