OGÓLNE ZASADY ZAPOBIEGANIA LECZENIA W

OGÓLNE ZASADY ZAPOBIEGANIA LECZENIA W CHOROBACH NARZĄDU ODDECHOWEGO TYTUL OGÓLNE ZASADY ZAPOBIEGANIA LECZENIA W CHOROBACH NARZĄDU ODDECHOWEGO Zapobieganie. Chorobom narządu oddechowego zapobiega się przede wszystkim przez unikanie działania czynników wywołujących oraz przez dokładne leczenie chorób, zwłaszcza zakaźnych i narządu krążenia, które często są przyczyną zmian chorobowych w narządzie oddechowym. Dużą rolę zapobiegawczą odgrywa także hartowanie ciała. Osiąga się je już przez systematyczne wycieranie ciała 1-2 razy dziennie gąbką, umoczoną w wodzie o ciepłocie początkowo 32° C, a później stopniowo coraz niższej aż do 20° C, z następowym wycieraniem skóry na sucho zgrzebnym prześcieradłem. Działanie tego zabiegu można zwiększyć przez dodanie łyżki stołowej soli kuchennej na szklankę wody albo spirytusu w stosunku 1 : 1 lub 1 : 2 wody. Continue reading „OGÓLNE ZASADY ZAPOBIEGANIA LECZENIA W”

Leczenie zgeszczonym powietrzem przeprowadza sie

Leczenie zgęszczonym powietrzem przeprowadza się w komorach pneumatycznych TYTUL Leczenie zgęszczonym powietrzem przeprowadza się w komorach pneumatycznych, zwanych także komorami nadciśniefilowymi. Komora składa się z 2 pomieszczeń, mianowicie z przedkomory i komory właściwej. Zadaniem przedkomory jest umożliwić w razie potrzeby szybką pomoc lekarską choremu znajdującemu się w komorze. Osiąga się to przez podniesienie ciśnienia powietrza w przedkomorze i równoczesne jego obniżenie w komorze. Po zrównaniu ciśnień w obu pomieszczeniach można już zastosować odpowiedni zabieg leczniczy. Continue reading „Leczenie zgeszczonym powietrzem przeprowadza sie”

wziernikowanie TYTUL Wziernika oskrzelowego uzywa sie

wziernikowanie TYTUL Wziernika oskrzelowego używa się podczas usuwania ciał obcych w oskrzelach oraz guzów oskrzeli. Wziernik umożliwia stosowanie miejscowego leczenia owrzodzeń i innych zmian chorobowych w oskrzelu pędzlowaniem przepłukiwaniem oskrzela i wprowadzaniem do oskrzeli leków, a także aspirowanie ropy i w ogóle wydzielin chorobowych. Samo wziernikowanie może odgrywać rolę metody leczniczej w gnilnym zapaleniu oskrzeli, usadowionym w dolnych płatach, i w zgorzeli dolnego płata płuc. Przywracając drożność oskrzeli zabieg ten doprowadza w tych chorobach powietrze do ogniska chorobowego i przez to stwarza warunki niepomyślne dla beztlenowców. Wypuszczanie wysięku opłucnego stosuje się w przypadkach dużego wysięku zagrażającego życiu chorego, a także w przypadkach w których, pomimo upłynięcia 4-ó tygodni od początku wysiękowego zapalenia opłucnej, wysięk nie ma skłonności do wsysania. Continue reading „wziernikowanie TYTUL Wziernika oskrzelowego uzywa sie”

Wyciecie chrzastek zebrowych TYTUL Zabieg

Wycięcie chrząstek żebrowych TYTUL Zabieg ten poleca się: a) do wywołania trwałego ucisku płuca w przypadkach rozległych rozszerzeń oskrzeli oraz długo trwających ropni płuc o ścianach twardych niezdolnych do samorzutnego zapadnięcia się; b) w dużej marskości płuca do usunięcia znacznego niestosunku między objętością płuc a objętością klatki piersiowej c) w przypadkach przetok płucnych o dużym otworze. Niezbędny warunek do powodzenia torakoplastyki pozaopłucnej stanowią sprawny narząd krążenia, dobry ogólny stan chorego i dostateczna wydolność drugiego płuca. Wycięcie chrząstek żebrowych. Z innych zabiegów na klatce piersiowej wspomnę jeszcze o wycięciu chrząstek kilku żeber w okolicy przymostkowej, polecone w przypadkach dużej rozedmy płuc u osób z niepodatną klatką piersiową. Zabieg ten nie znalazł szerokiego zastosowania. Continue reading „Wyciecie chrzastek zebrowych TYTUL Zabieg”

Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 3

Pacjenci z leczonymi przerzutami do mózgu mogli się zapisać, jeśli guzy były stabilne radiologicznie przez co najmniej 8 tygodni. Główne kryteria wykluczenia obejmowały historię choroby autoimmunologicznej lub inne choroby wymagające ogólnoustrojowego leczenia glikokortykoidami lub immunosupresyjne, poprzednia terapia przeciwciałami modulującymi komórki T (w tym anty-PD-1, anty-PD-L1 i anty-CTLA-4), historię zakażenia ludzkim wirusem upośledzenia odporności lub aktywne zakażenie wirusem zapalenia wątroby typu B lub C.
Badanie Leczenie i ocena bezpieczeństwa
Pacjenci byli leczeni w 6-tygodniowych cyklach. Przeciwciało anty-PD-L1 podawano jako 60-minutowy wlew dożylny w dniach 1, 15 i 29 każdego cyklu. Continue reading „Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 3”

Leczeniem odkazajacym narzad oddechowy jest

Leczeniem odkażającym narząd oddechowy jest również leczenie nowarsenobenzolem TYTUL Leczeniem odkażającym narząd oddechowy jest również leczenie nowarsenobenzolem lub neosalutanem w postaci dożylnego wstrzykiwania. Leki te działają skutecznie zwłaszcza w tych przypadkach, w których czynnikiem chorobotwórczym są krętki. Wstrzykuje się nowarsenobenzol, lub neosalutan w dawkach wzrastających raz w tygodniu, zaczynając od 0,15 i dochodząc do 0,3. W razie niemożności z jakiejkolwiek przyczyny zastosowania dożylnego można uciec się do wprowadzenia arsenobenzolu w czopkach Corbierea (po czopku zawierającym 0,1 leku co dzień okresami po 12 dni z 10-dniowymi przerwami po każdym okresie) albo też zastąpić leczenie salwarsanowe leczeniem acetylarsenem. Lek ten wstrzykuje się domięśniowo lub podskórnie co 3 dni okresami po 16 wstrzykiwań z przerwą co najmniej miesięczną po ukończonym okresie. Continue reading „Leczeniem odkazajacym narzad oddechowy jest”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

Śmiertelność i choroby sercowo-naczyniowe w cukrzycy typu 1 i 2 ad 6

W grupie pacjentów z cukrzycą typu 2 zaobserwowano 18% większe zmniejszenie częstości hospitalizacji z powodu niewydolności serca (współczynnik ryzyka, 1,18, 95% CI, 1,12 do 1,23, P <0,001) (ryc. S1 i S2 oraz tabele S8 i S9 w Dodatku Uzupełniającym). Dyskusja
Nasza analiza szwedzkich danych z całego kraju z lat 1998-2014 wykazała wyraźne zmniejszenie śmiertelności oraz częstości występowania powikłań sercowo-naczyniowych u osób dorosłych z cukrzycą typu lub cukrzycą typu 2. Zmniejszenie częstości zgonów nie różniło się istotnie pomiędzy pacjentami z cukrzycą typu a grupą kontrolną, podczas gdy pacjenci z cukrzycą typu 2 mieli mniejszy odsetek śmiertelnych wypadków niż osoby kontrolne. Tempo niepowodzeń nie było jednak większe u pacjentów z cukrzycą niż w odpowiedniej grupie kontrolnej. Continue reading „Śmiertelność i choroby sercowo-naczyniowe w cukrzycy typu 1 i 2 ad 6”

Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego ad 8

W analizie post hoc różnice te pozostały znaczące w 12-miesięcznym punkcie czasowym, ale nie w drugorzędowym punkcie czasowym wyniku wynoszącym 24 miesiące (tabela 2 i wykres 2). Ponieważ testy interakcji między leczeniem a określonymi podgrupami były nieistotne, nie było dowodów na zróżnicowany efekt minocykliny w poszczególnych podgrupach, z wyjątkiem możliwości porównania między podgrupami jednoogniskowymi i wieloogniskowymi (ryc. S1 w dodatku uzupełniającym). Znaczącą modyfikację efektu leczenia zaobserwowano w przypadku objawów jednoogniskowych w porównaniu z objawami wieloogniskowymi (p = 0,02 w przypadku interakcji), chociaż analiza nie została skorygowana dla wielokrotnych porównań. W ciągu 6 miesięcy po randomizacji 7 osób z grupy minocykliny i 14 osób z grupy placebo osiągnęło wyniki po nawrocie. Continue reading „Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego ad 8”

Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego ad 7

Ogólnie, dane dla 32 uczestników (22,5%) zostały ocenzurowane w 24-miesięcznej analizie zamiaru leczenia. W ciągu 24 miesięcy wycofywanie z badań z powodu działań niepożądanych badanego leku lub placebo było częstsze w grupie z minocykliną niż w grupie placebo (6 uczestników w grupie minocyklinowej w porównaniu z w grupie placebo), ale wypłaty z innych przyczyn były zrównoważony między badanymi grupami. Ogółem 13 uczestników (9,2%) przerwało stosowanie badanego leku lub placebo, ale kontynuowali obserwację aż do osiągnięcia wyniku badania lub 24 miesiąca (9 uczestników w grupie minocykliny i 4 w grupie placebo); włączono je do analizy zamiaru leczenia. Średni czas leczenia był podobny w obu grupach badawczych: 12,7 miesiąca w grupie minocykliny i 11,5 miesiąca w grupie placebo (P = 0,41 w teście t Studenta). Odpowiedni efekt oślepienia przydziału grupy badanej został potwierdzony wśród uczestników, pielęgniarek i lekarzy (Tabela Główny wynik
Tabela 2. Continue reading „Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego ad 7”