MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 4

Zbadano nuklearną i cytoplazmatyczną ekspresję NF-.B p65 za pomocą barwienia immunofluorescencyjnego, 17 przy użyciu króliczego poliklonalnego antyludzkiego przeciwciała NF-.B p65 (Cell Signaling), a następnie ospy przeciwgrubne IgG-DyLight 488 drugorzędowe przeciwciało (Abcam). Analiza statystyczna
Zmienne kategoryczne porównano z użyciem dokładnego testu prawdopodobieństwa Fishera i zmiennych porządkowych za pomocą testu U Manna-Whitneya. Wartości P skorygowano dla wielokrotnych porównań zgodnie z metodą Benjaminiego i Hochberga. Wartości P równe 0,05 lub mniej były uważane za wskazujące na istotność statystyczną. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 4”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 9

Mediana zajętości receptora wynosiła ponad 65% w przypadku badanych dawek. Chociaż badania te dostarczają bezpośredniej oceny i dowodu na docelowe zaangażowanie u pacjentów otrzymujących przeciwciała anty-PD-L1, zależności między zajętością receptora we krwi obwodowej a mikrośrodowiskiem nowotworu pozostają słabo poznane. Główną implikacją klinicznej aktywności blokowania punktu kontrolnego jest to, że generowane są znaczące endogenne odpowiedzi immunologiczne na antygeny nowotworowe, i te odpowiedzi mogą być wykorzystane terapeutycznie do pośredniczenia w klinicznej regresji guza przy hamowaniu punktu kontrolnego. Wyłaniającą się koncepcją immunologii nowotworów jest to, że hamujące ligandy, takie jak PD-L1, są indukowane w odpowiedzi na atak immunologiczny, mechanizm określany jako oporność adaptacyjna.22,32 Ten potencjalny mechanizm oporności immunologicznej przez nowotwory sugeruje, że terapia ukierunkowana na blokowanie interakcji między PD. Continue reading „Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 9”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 8

MYD88 L265P może być zatem przydatny w odróżnianiu LPL od chłoniaka z marginesu strefy i szpiczaka mnogiego – często trudnego zadania z powodu zachodzenia na siebie morfologicznych, immunofenotypowych, cytogenetycznych i klinicznych cech.2,18,19 W porównaniu z poziomem ekspresji MYD88 L265P w LPL, niższe poziomy ekspresji MYD88 L265P odnotowano w rozlanym chłoniaku z dużych komórek aktywowanego typu komórek B (14 do 29%), chłoniaka limfatycznego związanego z błoną śluzową (9%) i przewlekłej białaczki limfatycznej (3%) .20-22 Szczególnie interesujący był brak MYD88 L265P u większości, ale nie u wszystkich, pacjentów z IgM MGUS ocenionych przez sekwencjonowanie Sangera. Tylko 2 z 21 pacjentów z IgM MGUS (10%) miało ekspresję MYD88 L265P, obaj mieli subcentymetrową adenopatię, ale bez nacieku szpiku kostnego, co jest wymagane do kliniczno-patologicznej diagnozy makroglobulinemii Waldenströma.1,2 Jeden z tych pacjentów miał progresywny choroby, o czym świadczy seryjny wzrost poziomów IgM w surowicy i spadek hematokrytu; choroba została niedawno zdiagnozowana u innego pacjenta, a czas obserwacji był krótki. Znaczenie tych odkryć dla określenia związku IgM MGUS z makroglobulinemią Waldenströma pozostaje wyjaśnione. Kusi do spekulacji, że nabycie MYD88 L265P reprezentuje zdarzenie transformujące, które ułatwia progresję IgM MGUS do makroglobulinemii Waldenströma. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 8”

Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego czesc 4

Niezależni czytelnicy z University of British Columbia, MS / MRI Research Group, którzy nie byli świadomi zadań z grupy badawczej, ocenili skany MRI pod kątem akceptowalnej jakości i zgłosili liczbę i anatomiczny rozkład zmian demielinizacyjnych. Aby zminimalizować zmienność interpretacji obrazów, skany MRI dla każdego uczestnika zostały ocenione przez tego samego czytelnika, jak opisano wcześniej. 14. Ankietę dotyczącą skuteczności oślepiania przydziału grupy badawczej wypełniło uczestnik, pielęgniarka próbna i lekarz prowadzący. pod koniec badania lub wizyty w miesiącu 24. Continue reading „Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego czesc 4”

Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego ad 9

Obecność więcej niż jednej wzmagającej zmiany w punkcie wyjściowym była czynnikiem zakłócającym w naszej analizie, ale znaczące różnice między grupą minocykliny i grupą placebo utrzymywały się po dostosowaniu do tego odkrycia. Wpływ minocykliny na wyniki MRI w tej próbie był podobny do tego w poprzednich małych próbach w rzutowo-remisyjnym stwardnieniu rozsianym.7,8 Badanie to było krótsze i mniejsze niż inne próby terapii klinicznie izolowanego zespołu (tabele S11, S12 i S13 w dodatkowym dodatku). Po 6 miesiącach, 61,0% uczestników grupy placebo w tym badaniu osiągnęło wynik konwersji na stwardnienie rozsiane na podstawie kryteriów McDonalda z 2005 r., W porównaniu z odsetkami od 60 do 70% w grupach placebo w innych badaniach terapii. w przypadku klinicznie izolowanego zespołu.20-23 W momencie rozpoczęcia tej próby nastąpiła ogólna akceptacja kryteriów McDonalda z 2005 r., które pozwoliły na postawienie diagnozy stwardnienia rozsianego przed drugim nawrotem klinicznym, jeśli zaobserwowano nowe zmiany w obserwacji po MRI ; w związku z tym nieetyczne było zwracanie się do uczestników badania o kontynuowanie otrzymywania placebo po osiągnięciu wyniku konwersji na stwardnienie rozsiane. Z tego powodu udział w tej próbie zaplanowano na 24 miesiące lub gdy uczestnicy osiągnęli wynik konwersji na stwardnienie rozsiane. Continue reading „Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego ad 9”

Genetyczne przyczyny wad nerek w zespole DiGeorge czesc 4

Przesłuchanie bazy danych 22q i ty ze szpitala dziecięcego w Filadelfii pozwoliło na stwierdzenie wad wrodzonych nerek u 2 z 10 pacjentów z delecją 22q11.2 między LCR22 C i D (tabela S4 w dodatkowym dodatku). Na koniec ponownie przeanalizowaliśmy trzy kontrole z usuniętymi 22q11.2; jeden niósł typową delecję między LCR22 A i D, jedną z delecją między B i D i jedną delecją między C i D. Uzyskaliśmy zapisy kliniczne dla kontrolnej C1, u których wystąpiła choroba Parkinsona, wrodzona niedoczynność przytarczyc i zaawansowana przewlekła choroba nerek ( Tabela W związku z tym znaleźliśmy pacjenta z nierozpoznanym zespołem DiGeorge z zajęciem nerki wśród 22 000 kontroli populacji, co zapewniło dalsze wsparcie dla patogenności delecji 22q11.2 u pacjentów z wrodzonymi wadami nerek i układu moczowego. Po usunięciu tego pacjenta z zestawu danych kontrolnych, siła asocjacji pomiędzy delaminacjami 22q11,2 a agenezją nerek lub hipodysplazją dalej wzrastała (12 z 1093 pacjentów vs. 2 z 22093 kontroli, P = 8,5 x 10-15, iloraz szans, 123,7). Continue reading „Genetyczne przyczyny wad nerek w zespole DiGeorge czesc 4”

Genetyczne przyczyny wad nerek w zespole DiGeorge ad 7

Odwrotnie, SERPIND1, SNAP29, CRKL i THAP7 niosą mutacje powodujące utratę funkcji w nie więcej niż 2 na 10 000 osób. Spośród ponad 60 500 publicznie dostępnych kontroli populacji z bazy Exome Aggregation Consortium (ExAC) (exac.broadinstitute.org) tylko miał w CRKL wysokiej jakości wariant utraty funkcji, który plasuje się w górnej drugiej percentyl genom dla haploinsuficiency – innymi słowy, istnieje wysokie prawdopodobieństwo szkodliwego wpływu na fenotyp, gdy usuwana jest tylko jedna kopia genu. To odkrycie sugeruje, że zmiany utraty funkcji CRKL mają szkodliwy wpływ na sprawność genetyczną (tabela S3 w dodatku uzupełniającym) .39 Przeprowadziliśmy także ukierunkowane sekwencjonowanie następnej generacji wszystkich 107 egzonów kodujących PI4KA, SERPIND1, SNAP29, CRKL, AIFM3, THAP7, P2RX6 i SLC7A4 u 526 pacjentów z agenezją nerek lub hipodysplazją. Zidentyfikowaliśmy sześć wariantów utraty funkcji u 11 pacjentów: dwa w SERPIND1, jeden w CRKL, jeden w AIFM3 i dwa w P2RX6 (u 7 pacjentów) (tabela S7 w dodatkowym dodatku). Mutacje utraty funkcji w SERPIND1 powiązano z mendlowską chorobą krzepnięcia (niedoborem kofaktora II heparyny), która nie jest znana w związku z rozwojem nerek i dróg moczowych.40 W przeciwieństwie do tego stwierdzono mutację CRKL, p.Q31 *, u pacjenta (P13) z izolowaną jednostronną agenezją nerek i przewidywano, że będzie skutkować niewydolnością serca. Continue reading „Genetyczne przyczyny wad nerek w zespole DiGeorge ad 7”

Wpływ supresji herpes simpleks na występowanie wirusa HIV wśród kobiet w Tanzanii ad

Głównym celem tego badania było ustalenie, czy standardowy supresyjny schemat acyklowiru zmniejszyłby częstość zakażenia wirusem HIV w kohorcie zawodowej kobiet, u których wysoki odsetek zakażeń HIV można przypisać HSV-2. Metody
Uczestnicy
Kobiety od 16 do 35 lat w 19 społecznościach w północno-zachodniej Tanzanii, które pracowały w barach, pensjonatach i innych obiektach żywnościowych i rekreacyjnych, zostały zaproszone do wzięcia udziału w klinikach mobilnych i zostały przebadane pod kątem obecności przeciwciał HSV-2 i HIV, jak opisano wcześniej. 4 Po selekcji zostali zaproszeni do powrotu do kliniki około 8-12 tygodni później. Aby zakwalifikować się do rejestracji, uczestnicy musieli być HSV-2-seropozytywni, od 16 do 35 lat, nie w ciąży lub planujący ciążę w ciągu najbliższych 2 lat, a nie karmić piersią. Musieli mieszkać w pobliżu miejsca próbnego, bez planów przeniesienia, i musieli być obecni na stronie w czasie następnej zaplanowanej wizyty. Continue reading „Wpływ supresji herpes simpleks na występowanie wirusa HIV wśród kobiet w Tanzanii ad”

Wpływ supresji herpes simpleks na występowanie wirusa HIV wśród kobiet w Tanzanii ad 6

Uczestnicy grupy placebo nieznacznie rzadziej zgłaszali seks w zamian za pieniądze lub podarunki niż ci w grupie acyklowiru (24% vs. 27%, iloraz szans dla grupy acyklowir, 1,15, 95% CI, 0,91 do 1,45). Dostosowanie do tych czynników nie miało większego wpływu na stosunek częstości dla grupy acyklowiru (1,06; 95% CI, 0,62 do 1,79, dostosowane do liczby partnerów i 1,05; 95% CI, 0,62 do 1,79, dostosowane dla partnerów z wymianą pieniędzy lub prezenty). Podczas badania na zaplanowanych wizytach kontrolnych stwierdzono sześć epizodów owrzodzenia narządów płciowych lub pęcherzyków w grupie placebo w porównaniu z dziewięcioma epizodami w grupie acyklowiru (iloraz szans dla grupy acyklowirowej 1,69; 95% CI, 0,61 do 4,70). Wśród uczestników z takimi epizodami, HSV wykryto w trzech w grupie placebo i jednej w grupie acyklowiru. Continue reading „Wpływ supresji herpes simpleks na występowanie wirusa HIV wśród kobiet w Tanzanii ad 6”