Wypuszczanie wysieku oplucnego TYTUL Wypuszczanie wysieku

Wypuszczanie wysięku opłucnego TYTUL Wypuszczanie wysięku opłucnego przerywa się, jeżeli: 1) pojawia się silny kaszel, zwłaszcza zaś plwocina pienista; 2) pojawiają się zawroty głowy świadczące o niedokrwieniu mózgu; 3) zwiększa się duszność oraz pojawia się ściskanie w piersiach, zależnie od zaburzenia krążenia wskutek bardzo szybkiego lub nadmiernego wypuszczenia wysięku; 4) pojawiają się bardzo sile bóle w klatce piersiowej wskutek znacznego rozciągnięcia zrostów; 5) wysięk przybiera barwę krwawą wskutek pęknięcia zrostu z naczyniem krwionośnym albo naczynia na powierzchni płuca; 6) w wysięku pojawiają się pęcherzyki powietrza wskutek rozdarcia się płuca. Zdarzają się chociaż rzadko, przypadki, w których natychmiast po nakłuciu klatki piersiowej występują objawy świadczące o zatorze powietrznym (embolia aeria) w dużym krążeniu. Sprawę tę szczegółowo omawiam w tomie III w rozdziale o powikłaniach w leczeniu gruźlicy płuc odmą opłucną. Gdy zator powstanie, zabieg trzeba natychmiast przerwać i ułożyć chorego tak, by górna część ciała, a zwłaszcza głowa, znajdowała się niżej. W ten sposób zapobiega się dostaniu się powietrza do mózgu. Continue reading „Wypuszczanie wysieku oplucnego TYTUL Wypuszczanie wysieku”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci

W Stanach Zjednoczonych dzieci otrzymują pięć dawek szczepionki przeciw błonicy, tężcowi i bezkomórkowej krztuśca (DTaP) przed ukończeniem 7 roku życia. Czas trwania ochrony po podaniu pięciu dawek DTaP nie jest znany. Metody
Oceniliśmy ryzyko wystąpienia krztuśca u dzieci w Kalifornii w stosunku do czasu od piątej dawki DTaP w latach 2006-2011. Okres ten obejmował duży wybuch w 2010 roku. Continue reading „Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci”

Skuteczność rekombinowanej szczepionki przeciw grypie u dorosłych w wieku 50 lat lub starszych ad 6

CI oznacza przedział ufności. Rysunek 3. Rycina 3. Względna skuteczność szczepionki w różnych podgrupach populacji. Ryzyko względne to odsetek uczestników z udokumentowaną grypą w grupie RIV4 (współczynnik ataku RIV4) podzielony przez procent uczestników z udokumentowaną grypą w grupie IIV4 ( Współczynnik ataków IIV4). Continue reading „Skuteczność rekombinowanej szczepionki przeciw grypie u dorosłych w wieku 50 lat lub starszych ad 6”