Tezyczka ukryta

Tężyczka ukryta Późniejsze badania doświadczalne wykazały możliwość istnienia ukrytych stanów -tężyczki, które są istotą choroby zwanej spazmofilią i częściowo takie rzucawki porodowej. U psów np. p usunięciu 3 przytarczyczek występuje bardzo lekka tężyczka, która po pewnym czasie całkowicie mija. Jeżeli tak operowane samice urodzą młode, to po porodzie występuje u samic tężyczka w bardzo ciężkiej postaci. Ciąża może również wywołać tężyczkę u zwierząt z częściowo usuniętymi przytarczyczkami. Continue reading „Tezyczka ukryta”

Badanie bakteriologiczne plwociny TYTUL Badanie bakteriologiczne

Badanie bakteriologiczne plwociny TYTUL Badanie bakteriologiczne plwociny ma szczególne znaczenie dla rozpoznania chorób narządu oddechowego wywołanych przez swoiste bakterie, np. przez prątki gruźlicy, pneumokoki, pałeczki dżumy. W tym celu najczęściej sporządza się z plwociny utrwalone preparaty, a następnie zabarwia się je uciekając się do metody umożliwiającej zróżnicowanie zarazka chorobotwórczego. W innych przypadkach trzeba czasami uciec się do hodowli bakteriologicznej lub do szczepienia plwociny świnkom morskim. Z różnych metod barwienia plwociny do badania bakterioskopowego podam tylko metodę Grama, którą jedne bakterie barwią się, a inne odbarwiają się. Continue reading „Badanie bakteriologiczne plwociny TYTUL Badanie bakteriologiczne”

Cieple plyny rozpylane w postaci

Ciepłe płyny rozpylane w postaci mgły o dużej dyspersji mogą docierać aż do pęcherzyków płucnych TYTUL Ciepłe płyny rozpylane w postaci mgły o dużej dyspersji mogą docierać aż do pęcherzyków płucnych wywierając działanie tak miejscowe na całym przebiegu dróg oddechowych, jak i ogólne na ustrój gdyż one bardzo szybko wchłaniają się, zwłaszcza w oskrzelkach i pęcherzykach płucnych. Dla wziewań stosuje się solanki naturalne o stężeniu 0,2-4% chlorku. Sodowego lub działające łagodniej wody mineralne alkaliczne i alkaliczno-słone, które rozpuszczają śluz, ułatwiają jego wykrztuszanie i łagodzą stan -zapalny dróg oddechowych. Osobom niemającym możności udania się do zdrojowiska leczenie wziewaniami poleca się przeprowadzać w domu chory wziewa za pomocą inhalatora 2-3 razy dziennie po 5-15 minut sodę z solą kuchenną (Rp. Nutrii bicarbonici, Natrii muriaticiana 1,0, Aq. Continue reading „Cieple plyny rozpylane w postaci”

Metoda leczenia wzmacniajaca TYTUL Metoda

Metoda leczenia wzmacniająca TYTUL Metoda leczenia wzmacniająca (Methodus medendi roborans) Metoda wzmacniająca znajduje szerokie zastosowanie w chorobach narządu oddechowego, zarówno w czasie ich trwania jak i po ich ukończeniu, a to ze względu na to, że choroby te często pozostawiają po sobie skłonność do nawrotów oraz łatwo ulegają zaostrzeniu. Szczególnie dotyczy to gruźlicy płuc i chorób opłucnej. Wzmacnianie oporności ustroju osiąga się różnymi sposobami. Temu celowi służy już hartowanie ciała oraz leczenie higieniczno-klimatyczne połączone z regularnym trybem życia i dobrym odżywianiem. Prócz tego, zwłaszcza u osób osłabionych i wyniszczonych, stosuje się leczenie przetworami arsefiui fosforu. Continue reading „Metoda leczenia wzmacniajaca TYTUL Metoda”

Wypuszczanie wysieku oplucnego TYTUL Wypuszczanie wysieku

Wypuszczanie wysięku opłucnego TYTUL Wypuszczanie wysięku opłucnego przerywa się, jeżeli: 1) pojawia się silny kaszel, zwłaszcza zaś plwocina pienista; 2) pojawiają się zawroty głowy świadczące o niedokrwieniu mózgu; 3) zwiększa się duszność oraz pojawia się ściskanie w piersiach, zależnie od zaburzenia krążenia wskutek bardzo szybkiego lub nadmiernego wypuszczenia wysięku; 4) pojawiają się bardzo sile bóle w klatce piersiowej wskutek znacznego rozciągnięcia zrostów; 5) wysięk przybiera barwę krwawą wskutek pęknięcia zrostu z naczyniem krwionośnym albo naczynia na powierzchni płuca; 6) w wysięku pojawiają się pęcherzyki powietrza wskutek rozdarcia się płuca. Zdarzają się chociaż rzadko, przypadki, w których natychmiast po nakłuciu klatki piersiowej występują objawy świadczące o zatorze powietrznym (embolia aeria) w dużym krążeniu. Sprawę tę szczegółowo omawiam w tomie III w rozdziale o powikłaniach w leczeniu gruźlicy płuc odmą opłucną. Gdy zator powstanie, zabieg trzeba natychmiast przerwać i ułożyć chorego tak, by górna część ciała, a zwłaszcza głowa, znajdowała się niżej. W ten sposób zapobiega się dostaniu się powietrza do mózgu. Continue reading „Wypuszczanie wysieku oplucnego TYTUL Wypuszczanie wysieku”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci

W Stanach Zjednoczonych dzieci otrzymują pięć dawek szczepionki przeciw błonicy, tężcowi i bezkomórkowej krztuśca (DTaP) przed ukończeniem 7 roku życia. Czas trwania ochrony po podaniu pięciu dawek DTaP nie jest znany. Metody
Oceniliśmy ryzyko wystąpienia krztuśca u dzieci w Kalifornii w stosunku do czasu od piątej dawki DTaP w latach 2006-2011. Okres ten obejmował duży wybuch w 2010 roku. Continue reading „Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci”

Skuteczność rekombinowanej szczepionki przeciw grypie u dorosłych w wieku 50 lat lub starszych ad 6

CI oznacza przedział ufności. Rysunek 3. Rycina 3. Względna skuteczność szczepionki w różnych podgrupach populacji. Ryzyko względne to odsetek uczestników z udokumentowaną grypą w grupie RIV4 (współczynnik ataku RIV4) podzielony przez procent uczestników z udokumentowaną grypą w grupie IIV4 ( Współczynnik ataków IIV4). Continue reading „Skuteczność rekombinowanej szczepionki przeciw grypie u dorosłych w wieku 50 lat lub starszych ad 6”

Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego cd

Przy zastosowaniu kryteriów McDonalda z 2005 r. 9 drugi rzut choroby nie był już wymagany, ponieważ rozpoznanie stwardnienia rozsianego można było potwierdzić na podstawie pojawienia się nowej zmiany demielinizacyjnej w kontrolnym badaniu MRI (spełniającym kryterium rozpowszechniania w czasie), jeśli: były zmiany obejmujące kilka obszarów mózgu, zwykle zaangażowanych w stwardnienie rozsiane (spełniające kryterium rozpowszechniania w kosmosie). W związku z kryteriami McDonalda z 2010 r. 10 obecność zarówno zmian wzmacniających, jak i nie-nabrzmiałych w początkowym badaniu MRI potwierdziła rozpowszechnienie w czasie, ponieważ obecnie wiadomo było, że zmiany były w różnym wieku. Ponadto zmiany nie musiały być tak rozpowszechnione, jak wymagane w kryteriach McDonalda z 2005 roku, aby potwierdzić rozpowszechnienie w przestrzeni kosmicznej, tak więc diagnoza może zostać potwierdzona na początku pierwszego zdarzenia demielinizacyjnego, gdy te warunki zostaną spełnione. Continue reading „Próba Minocykliny w klinicznie izolowanym zespole stwardnienia rozsianego cd”

Genetyczne przyczyny wad nerek w zespole DiGeorge

Zespół DiGeorge, najczęstszy z zespołów mikrodelecji, atakuje wiele narządów, w tym serce, układ nerwowy i nerkę. Jest spowodowane delecją chromosomu 22q11.2; genetyczny napęd wad nerek jest nieznany. Metody
Przeprowadziliśmy poszukiwanie genów w poszukiwaniu wariantów strukturalnych w dwóch kohortach: 2080 pacjentów z wrodzonymi wadami nerek i dróg moczowych oraz 2294 osoby kontrolne. Wykonaliśmy exome i celowane resekwencjonowanie w próbkach pobranych od 586 dodatkowych pacjentów z wrodzonymi anomaliami nerek. Przeprowadziliśmy również badania czynnościowe z użyciem danio pręgowanego i myszy. Continue reading „Genetyczne przyczyny wad nerek w zespole DiGeorge”