MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 2

Rodzinne grupowanie makroglobulinemii Waldenströma i innych zaburzeń komórek B sugeruje, że czynniki genetyczne odgrywają rolę w patogenezie makroglobulinemii Waldenströma u niektórych pacjentów.4-6 Gammopatia monoklonalna IgM o nieznanym znaczeniu (MGUS) charakteryzuje się obecnością monoklonalnego białka IgM oraz brak zajęcia szpiku na histologicznym badaniu.1 IgM MGUS może przejść do makroglobulinemii Waldenströma lub innych zaburzeń limfoproliferacyjnych limfocytów B, z szacowanym prawdopodobieństwem progresji 1,5 do 3,0% rocznie. 7-9 Przypadki onkogenne odpowiedzialne za progresja IgM MGUS do makroglobulinemii Waldenströma jest nieznana. Znajomość genetycznych zdarzeń odpowiedzialnych za patogenezę makroglobulinemii Waldenströma może pozwolić na postęp w badaniach diagnostycznych i opracowaniu terapii celowanych. Metody
Pacjenci i próbki komórek
Przeprowadziliśmy sekwencjonowanie całego genomu u 30 pacjentów, którzy spełnili kryteria diagnostyczne dla makroglobulinemii Waldenströma.1 Ich udział został zatwierdzony przez instytutowy organ recenzujący w Dana-Farber Cancer Institute, a my złożyliśmy wniosek o odłożenie danych dotyczących sekwencjonowania całego genomu. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 2”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma

Makroglobulinemia Waldenströma jest nieuleczalnym, chłoniakiem limfoplazmatycznym wydzielającym IgM (LPL). Podstawowa mutacja w tym zaburzeniu nie została wyznaczona. Metody
Przeprowadziliśmy sekwencjonowanie całego genomu komórek LPL szpiku kostnego u 30 pacjentów z makroglobulinemią Waldenströma, z parami prawidłowych tkanek i sekwencjonowania tkanek nowotworowych u 10 pacjentów. Sekwencjonowanie Sanger zastosowano do potwierdzenia wyników w próbkach z rozszerzonej kohorty pacjentów z LPL, tych z innymi zaburzeniami komórek B, które mają niektóre z tych samych cech co LPL i zdrowych dawców. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma”

Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 9

Mediana zajętości receptora wynosiła ponad 65% w przypadku badanych dawek. Chociaż badania te dostarczają bezpośredniej oceny i dowodu na docelowe zaangażowanie u pacjentów otrzymujących przeciwciała anty-PD-L1, zależności między zajętością receptora we krwi obwodowej a mikrośrodowiskiem nowotworu pozostają słabo poznane. Główną implikacją klinicznej aktywności blokowania punktu kontrolnego jest to, że generowane są znaczące endogenne odpowiedzi immunologiczne na antygeny nowotworowe, i te odpowiedzi mogą być wykorzystane terapeutycznie do pośredniczenia w klinicznej regresji guza przy hamowaniu punktu kontrolnego. Wyłaniającą się koncepcją immunologii nowotworów jest to, że hamujące ligandy, takie jak PD-L1, są indukowane w odpowiedzi na atak immunologiczny, mechanizm określany jako oporność adaptacyjna.22,32 Ten potencjalny mechanizm oporności immunologicznej przez nowotwory sugeruje, że terapia ukierunkowana na blokowanie interakcji między PD. Continue reading „Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 9”

Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci

W Stanach Zjednoczonych dzieci otrzymują pięć dawek szczepionki przeciw błonicy, tężcowi i bezkomórkowej krztuśca (DTaP) przed ukończeniem 7 roku życia. Czas trwania ochrony po podaniu pięciu dawek DTaP nie jest znany. Metody
Oceniliśmy ryzyko wystąpienia krztuśca u dzieci w Kalifornii w stosunku do czasu od piątej dawki DTaP w latach 2006-2011. Okres ten obejmował duży wybuch w 2010 roku. Continue reading „Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 8

MYD88 L265P może być zatem przydatny w odróżnianiu LPL od chłoniaka z marginesu strefy i szpiczaka mnogiego – często trudnego zadania z powodu zachodzenia na siebie morfologicznych, immunofenotypowych, cytogenetycznych i klinicznych cech.2,18,19 W porównaniu z poziomem ekspresji MYD88 L265P w LPL, niższe poziomy ekspresji MYD88 L265P odnotowano w rozlanym chłoniaku z dużych komórek aktywowanego typu komórek B (14 do 29%), chłoniaka limfatycznego związanego z błoną śluzową (9%) i przewlekłej białaczki limfatycznej (3%) .20-22 Szczególnie interesujący był brak MYD88 L265P u większości, ale nie u wszystkich, pacjentów z IgM MGUS ocenionych przez sekwencjonowanie Sangera. Tylko 2 z 21 pacjentów z IgM MGUS (10%) miało ekspresję MYD88 L265P, obaj mieli subcentymetrową adenopatię, ale bez nacieku szpiku kostnego, co jest wymagane do kliniczno-patologicznej diagnozy makroglobulinemii Waldenströma.1,2 Jeden z tych pacjentów miał progresywny choroby, o czym świadczy seryjny wzrost poziomów IgM w surowicy i spadek hematokrytu; choroba została niedawno zdiagnozowana u innego pacjenta, a czas obserwacji był krótki. Znaczenie tych odkryć dla określenia związku IgM MGUS z makroglobulinemią Waldenströma pozostaje wyjaśnione. Kusi do spekulacji, że nabycie MYD88 L265P reprezentuje zdarzenie transformujące, które ułatwia progresję IgM MGUS do makroglobulinemii Waldenströma. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 8”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 7

Ponadto klonalna rearanżacja IgH była obecna w co najmniej części transkryptów u 7 z 11 pacjentów z IgM MGUS, z których żaden nie miał ekspresji MYD88 L265P, co wskazuje na obecność klonalnych komórek B w większości próbek stosowanych do sekwencjonowania Sanger. Hamowanie sygnalizacji MYD88 w komórkach wyrażających L265P
Rysunek 1. Rycina 1. Hamowanie różnicowania mieloidowego Pierwotny gen odpowiedzi (88) (MYD88) Sygnalizacja i wpływ na czynnik jądrowy Ekspresja .B (NF-.B) p65 w jądrach komórek makroglobulinemii Waldenströma. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 7”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 6

Ponadto staraliśmy się zidentyfikować warianty wyłącznie dla pacjentów z MYD88 typu dzikiego. U 2 z 3 pacjentów z MYD88 typu dzikiego zidentyfikowano warianty w genie 2 białaczki mieszanej (MLL2) i potwierdzono, że są somatyczne po tym, jak u tych pacjentów przeprowadzono sekwencjonowanie prawidłowej tkanki Sanger. Jeden z tych 2 pacjentów miał wariant pojedynczego nukleotydu w chromosomie 12 w pozycji 49425599 (A . G), a drugi pacjent miał delecję w pozycji 49448413 (C), co spowodowało mutację zmiany ramki odczytu. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 6”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 5

Spośród 4 pacjentów, którzy byli homozygotyczni pod względem MYD88 L265P, 2 miało dodatni wywiad rodzinny (stanowiący 22% wszystkich pacjentów z dodatnim wywiadem rodzinnym), a 2 miało przypadki sporadyczne (stanowiące 11% wszystkich pacjentów ze sporadycznymi przypadkami) ( P = 0,84). Nie stwierdzono powtarzających się wariantów somatycznych w innych genach kodujących szlaki sygnalizacyjne Toll-podobne lub NF-.B u 10 pacjentów z parami próbek. Kolejne najczęstsze warianty somatyczne, po MYD88, wystąpiły w bogatym w AT genu interaktywnej domeny 1A (ARID1A) i genie H1e histonu (HIST1H1E), z wariantami występującymi w każdym z tych genów u 2 z 10 pacjentów ze sparowaniem próbki (20%). Dwa niepowtarzające się warianty pojedynczego nukleotydu zidentyfikowano przez sekwencjonowanie całego genomu w każdym genie i potwierdzono przez sekwencjonowanie Sangera (patrz Tabela S2 w Dodatku Uzupełniającym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 5”

Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci AD 2

Jednak od lat 80. XX w., Mimo wysokiego poziomu pokrycia szczepionkami u dzieci, wybuchy B. pertussis pojawiały się co 3 do 5 lat, ze wzrostem szczytowej częstości występowania przy każdym kolejnym wybuchu epidemii.6 Przyczyny trwających wybuchów choroby nie są dobre. zrozumiałe i prawdopodobnie wieloczynnikowe.7-9 Otrzymanie pięciu dawek DTaP jest obowiązkowe przy wejściu do szkoły w wielu stanach, w tym w Kalifornii, z piątą dawką zazwyczaj podawaną u dzieci w wieku od 4 do 6 lat. Continue reading „Ochrona przed wirusem po piątej dawce szczepionki przeciwkomórkowej przeciwko krztuścowi u dzieci AD 2”