Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 4

Na podstawie początkowych sygnałów aktywności, do leczenia czerniaka (1 i 3 mg na kilogram) włączono dodatkowe kohorty ekspansji (do 16 pacjentów na kohortę), niedrobnokomórkowy rak płuca (podzielony na kohorty z płaskie lub podtypowe i losowo przydzielone do otrzymania 1, 3 lub 10 mg na kilogram) oraz raka trzustki, sutka i żołądka (wszystkie po 10 mg na kilogram). Farmakokinetyka i farmakodynamika
W analizach farmakokinetycznych zbieraliśmy seryjne próbki krwi do pomiaru poziomu anty-PD-L1 w surowicy za pomocą testu immunoenzymatycznego związanego z enzymem. Jednojądrzaste komórki krwi obwodowej izolowano od pacjentów na początku badania i po jednym cyklu leczenia w celu zbadania zajętości receptora PD-L1 przez anty-PD-L1 na krążących limfocytach T CD3 + za pomocą cytometrii przepływowej (patrz Metody S4 w Dodatku Uzupełniającym) .26
Przestudiuj badanie
Badanie było sponsorowane przez Bristol-Myers Squibb, który dostarczył badany lek i został zaprojektowany wspólnie przez przedstawicieli sponsora i starszych autorów akademickich, którzy zgromadzili, przeanalizowali i zinterpretowali wyniki badania. Wszyscy autorzy podpisali umowę o zachowaniu poufności ze sponsorem. Continue reading „Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 4”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 4

Zbadano nuklearną i cytoplazmatyczną ekspresję NF-.B p65 za pomocą barwienia immunofluorescencyjnego, 17 przy użyciu króliczego poliklonalnego antyludzkiego przeciwciała NF-.B p65 (Cell Signaling), a następnie ospy przeciwgrubne IgG-DyLight 488 drugorzędowe przeciwciało (Abcam). Analiza statystyczna
Zmienne kategoryczne porównano z użyciem dokładnego testu prawdopodobieństwa Fishera i zmiennych porządkowych za pomocą testu U Manna-Whitneya. Wartości P skorygowano dla wielokrotnych porównań zgodnie z metodą Benjaminiego i Hochberga. Wartości P równe 0,05 lub mniej były uważane za wskazujące na istotność statystyczną. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 4”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 2

Rodzinne grupowanie makroglobulinemii Waldenströma i innych zaburzeń komórek B sugeruje, że czynniki genetyczne odgrywają rolę w patogenezie makroglobulinemii Waldenströma u niektórych pacjentów.4-6 Gammopatia monoklonalna IgM o nieznanym znaczeniu (MGUS) charakteryzuje się obecnością monoklonalnego białka IgM oraz brak zajęcia szpiku na histologicznym badaniu.1 IgM MGUS może przejść do makroglobulinemii Waldenströma lub innych zaburzeń limfoproliferacyjnych limfocytów B, z szacowanym prawdopodobieństwem progresji 1,5 do 3,0% rocznie. 7-9 Przypadki onkogenne odpowiedzialne za progresja IgM MGUS do makroglobulinemii Waldenströma jest nieznana. Znajomość genetycznych zdarzeń odpowiedzialnych za patogenezę makroglobulinemii Waldenströma może pozwolić na postęp w badaniach diagnostycznych i opracowaniu terapii celowanych. Metody
Pacjenci i próbki komórek
Przeprowadziliśmy sekwencjonowanie całego genomu u 30 pacjentów, którzy spełnili kryteria diagnostyczne dla makroglobulinemii Waldenströma.1 Ich udział został zatwierdzony przez instytutowy organ recenzujący w Dana-Farber Cancer Institute, a my złożyliśmy wniosek o odłożenie danych dotyczących sekwencjonowania całego genomu. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 2”