MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 2

Rodzinne grupowanie makroglobulinemii Waldenströma i innych zaburzeń komórek B sugeruje, że czynniki genetyczne odgrywają rolę w patogenezie makroglobulinemii Waldenströma u niektórych pacjentów.4-6 Gammopatia monoklonalna IgM o nieznanym znaczeniu (MGUS) charakteryzuje się obecnością monoklonalnego białka IgM oraz brak zajęcia szpiku na histologicznym badaniu.1 IgM MGUS może przejść do makroglobulinemii Waldenströma lub innych zaburzeń limfoproliferacyjnych limfocytów B, z szacowanym prawdopodobieństwem progresji 1,5 do 3,0% rocznie. 7-9 Przypadki onkogenne odpowiedzialne za progresja IgM MGUS do makroglobulinemii Waldenströma jest nieznana. Znajomość genetycznych zdarzeń odpowiedzialnych za patogenezę makroglobulinemii Waldenströma może pozwolić na postęp w badaniach diagnostycznych i opracowaniu terapii celowanych. Metody
Pacjenci i próbki komórek
Przeprowadziliśmy sekwencjonowanie całego genomu u 30 pacjentów, którzy spełnili kryteria diagnostyczne dla makroglobulinemii Waldenströma.1 Ich udział został zatwierdzony przez instytutowy organ recenzujący w Dana-Farber Cancer Institute, a my złożyliśmy wniosek o odłożenie danych dotyczących sekwencjonowania całego genomu. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 2”

MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma

Makroglobulinemia Waldenströma jest nieuleczalnym, chłoniakiem limfoplazmatycznym wydzielającym IgM (LPL). Podstawowa mutacja w tym zaburzeniu nie została wyznaczona. Metody
Przeprowadziliśmy sekwencjonowanie całego genomu komórek LPL szpiku kostnego u 30 pacjentów z makroglobulinemią Waldenströma, z parami prawidłowych tkanek i sekwencjonowania tkanek nowotworowych u 10 pacjentów. Sekwencjonowanie Sanger zastosowano do potwierdzenia wyników w próbkach z rozszerzonej kohorty pacjentów z LPL, tych z innymi zaburzeniami komórek B, które mają niektóre z tych samych cech co LPL i zdrowych dawców. Continue reading „MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma”

Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 9

Mediana zajętości receptora wynosiła ponad 65% w przypadku badanych dawek. Chociaż badania te dostarczają bezpośredniej oceny i dowodu na docelowe zaangażowanie u pacjentów otrzymujących przeciwciała anty-PD-L1, zależności między zajętością receptora we krwi obwodowej a mikrośrodowiskiem nowotworu pozostają słabo poznane. Główną implikacją klinicznej aktywności blokowania punktu kontrolnego jest to, że generowane są znaczące endogenne odpowiedzi immunologiczne na antygeny nowotworowe, i te odpowiedzi mogą być wykorzystane terapeutycznie do pośredniczenia w klinicznej regresji guza przy hamowaniu punktu kontrolnego. Wyłaniającą się koncepcją immunologii nowotworów jest to, że hamujące ligandy, takie jak PD-L1, są indukowane w odpowiedzi na atak immunologiczny, mechanizm określany jako oporność adaptacyjna.22,32 Ten potencjalny mechanizm oporności immunologicznej przez nowotwory sugeruje, że terapia ukierunkowana na blokowanie interakcji między PD. Continue reading „Bezpieczeństwo i aktywność przeciwciała anty-PD-L1 u pacjentów z zaawansowanym rakiem AD 9”