MYD88 L265P Mutacja somatyczna w makroglobulinemii Waldenströma AD 3

Nierównowagę allelu określono na podstawie odsetka odczytów odwzorowanych na mniejszy allel przy heterozygotycznych polimorfizmach pojedynczych nukleotydów i uśredniono powyżej 500 Kb. Walidacja przez Sanger Sequencing
Startery do reakcji łańcuchowej polimerazy zaprojektowano do amplifikacji fragmentu o długości 726 bp pokrywającego gen pierwotnej odpowiedzi na różnicowanie mieloidów (88) (MYD88) L265P (przedni starter, 5 -GGGATATGCTGAACTAAGTTGCCAC3 , starter odwrotny, 5 -GACGTGTCTGTGAAGTTGGCATCTC3 ). Amplifikowane fragmenty izolowano przy użyciu zestawu QIAquick Gel Extraction Kit (Qiagen) i sekwencjonowano stosując przedni primer 5 GCTGTTGTTAACCCTGGGGTTGAAG3 i odwrotny primer 5 -GACGTGTCTGTGAAGTTGGCATCTC3 . Sekwencjonowanie Sanger wykorzystano do walidacji wyników sekwencjonowania całego genomu i do oceny ekspresji MYD88 L265P w próbkach nowotworu od 24 dodatkowych pacjentów z makroglobulinemią Waldenströma, 3 pacjentów z LPL bez IgM (2 z IgG LPL i z IgA LPL), 10 pacjentów ze szpiczakiem i 46 pacjentów z chłoniakiem strefy brzegowej (21 z podtypem śledziony, 20 z podrzędnym podtypem i 5 z podtypem węzłowym). Izolowano także komórki jednojądrzaste szpiku kostnego CD19 + wyizolowane od 21 pacjentów z IgUS MGUS, klonując i sekwencjonując co najmniej 100 klonów wykonanych przez Genewiz dla 7 pacjentów z IgM MGUS, u których bezpośrednie sekwencjonowanie Sangera nie ujawniło MYD88 L265P. Próbki z wystarczającym DNA od 11 pacjentów z IgM MGUS oceniano za pomocą testu przegrupowania IgH (In Vivo Scribe Technologies). CD19 + jednojądrzaste komórki krwi obwodowej od 15 zdrowych dawców i linie komórkowe BCWM.1, MWCL-1, WM-WSU, Ramos, MM1.S, RPMI 8226, MEC-1 i U266 również zsekwencjonowano dla MYD88 L265P.
Inhibitory sygnalizacji MYD88
Linie komórkowe makroglobulinemii BCWM.1 i MWCL-1 ekspresjonujące MYD88 L265P, komórki szpiku kostnego od pacjenta z makroglobulinemią Waldenströma i linie Ramos, MM1.S, RPMI 8226 i U266 eksprymujące MYD88 typu dzikiego inkubowano przez noc z 100 .M peptydu kontrolnego, 100 .M inhibitora homodimeryzacji MYD88 (IMG-2005-5, IMGENEX), kontroli nośnika dimetylosulfotlenku lub 10 .M kinazy związanej z receptorem podwójnej interleukiny (IRAK) i inhibitora kinazy IRAK4 ( 407601, EMD) .15,16
Analiza Western Blot i barwienie immunofluorescencyjne
Przeprowadzono blotting typu Western z użyciem całkowitego białka i fosfospecyficznych przeciwciał dla czynnika jądrowego wzmacniacza genów polipeptydu kappa lekkiego w inhibitorze komórek B, alfa (I.B.) (Ser32) (Cell Signaling), jądrowy czynnik .B (NF-.B) p65 ( Ser529) (BD Biosciences) i dehydrogenaza gliceraldehydo-3-fosforanowa (GAPDH) (Santa Cruz Biotechnology)
[patrz też: implanty zielona góra, dentysta Lublin, naklejka na legitymację ]